redbiom

  • Allows you to search through public studies to find comparable data to your own

  • Can search by: metadata, feature, or taxon

For more information, advanced queries and generating BIOM files go to the redbiom github page.

Search Options

  • Metadata:

    • The search will be on the full metadata.

    • Natural language processing: The metadata search engine uses natural language processing to search for word stems within a sample metadata. A word stem disregards modifiers and plurals, so for instance, a search for antibiotics will actually perform a search for antibiot. Similarly, a search for crying will actually search for cry. The words specified can be combined with set-based operations, so for instance, a search for antibiotics & crying will obtain the set of samples in which each sample has antibiot in its metadata as well as cry.

      N.B., the specific category in which a stem is found is not assured to be the same, antibiot could be in one category and cry in another. A set intersection can be performed with “&”, a union with “|” and a difference with “-“.

    • Value search: In addition to the stem-based search, value based searches can also be applied. These use a Python-like grammar and allow for a rich set of comparisons to be performed based on a metadata category of interest. For example, where qiita_study_id == 10317 will find all samples which have the qiita_study_id metadata category, and in which the value for that sample is 10317.

    • Examples:

      • Find all samples in which both the word ‘infant’, as well as ‘antibiotics’ exist, and where the infants are under a year old:

        • infant & antibiotics where age_years <= 1

      • Find all samples only belonging to the EMP in which the pH is under 7, for a variety of sample types:

        • soil: soil where ph < 7 and emp_release1 == ‘True’

        • ocean water: water & ocean where ph > 7 and emp_release1 == ‘True’

        • non-ocean water: water - ocean where ph > 7 and emp_release1 == ‘True’

      • Or instead of pH you could search for a different metadata category:

        • water & ocean where salinity > 20

      • Some other interesting examples:

        • feces & canine

        • (beer | cider | wine | alcohol)

        • where sample_type == ‘stool’

        • usa where sample_type == ‘stool’ and host_taxid == 9606

  • Feature:

    • The search will be on all the features, in specific: OTU ids for closed reference or exact sequences for deblur.

    • Examples:

      • Find all samples in which the Greengenes feature 4479944 is found: 4479944

      • Find all samples in which the sequence exists: TACGAAGGGTGCAAGCATTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTTCGTTAAGTCTGATGTGAAAGCCCTGGGCTCAACCTGGGAACTG

  • Taxon:

    • The search will be only on closed reference data and based on the taxonomies available. Only exact matches are returned. Note that currently only the Greengenes taxonomy is searchable, and that it requires nomenclature of a rank prefix, two underscores, and then the name.

    • Examples:

      • Find all samples in which the genera Escherichia is found: g__Escherichia

      • Find all samples in which the phylum Tenericutes is found: p__Tenericutes